View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_low_57 (Length: 234)
Name: NF0964_low_57
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0964_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 14609974 - 14610190
Alignment:
Q |
1 |
cttgttatgtttcagatgatggaggtgctcttttaacattcgaggccatggctgaggccgcaagttttgctgatttatgggttcccttttgtcgcaaaca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14609974 |
cttgttatgtttcagatgatggaggtgctcttttaacattcgaggccatggctgaggctgcaagttttgctgatttatgggttcccttttgtcgcaaaca |
14610073 |
T |
 |
Q |
101 |
caatattgagccaaggaatcctgattcttactttgcctcaaatgtcgatccaactaagaacaagagcagattagattttgtgaaggatagaagaagggtg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14610074 |
caatattgagccaaggaatcctgattcttactttgcctcaaatgtcgatccaactaagaacaagagcagattagattttgtgaaggatagaagaagggtg |
14610173 |
T |
 |
Q |
201 |
aagagggagtatgatga |
217 |
Q |
|
|
||||||||||||||||| |
|
|
T |
14610174 |
aagagggagtatgatga |
14610190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 14598502 - 14598286
Alignment:
Q |
1 |
cttgttatgtttcagatgatggaggtgctcttttaacattcgaggccatggctgaggccgcaagttttgctgatttatgggttcccttttgtcgcaaaca |
100 |
Q |
|
|
||||||||||||||||||||||||| ||||| || | || || || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14598502 |
cttgttatgtttcagatgatggaggagctctcttgagttttgaagcgatggctgaggccgcaagttttgctgatttatgggttcccttttgtcgcaaaca |
14598403 |
T |
 |
Q |
101 |
caatattgagccaaggaatcctgattcttactttgcctcaaatgtcgatccaactaagaacaagagcagattagattttgtgaaggatagaagaagggtg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| | ||| |||||||||| ||||||||||| | | | ||||| |||||||| |||||||||||| |
|
|
T |
14598402 |
caatattgagccaaggaatcctgattcttactttgcgttaaaaatcgatccaaccaagaacaagagtaaactggatttcgtgaaggacagaagaagggtg |
14598303 |
T |
 |
Q |
201 |
aagagggagtatgatga |
217 |
Q |
|
|
|| |||||||| ||||| |
|
|
T |
14598302 |
aaaagggagtacgatga |
14598286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 43 - 124
Target Start/End: Complemental strand, 41491900 - 41491819
Alignment:
Q |
43 |
aggccatggctgaggccgcaagttttgctgatttatgggttcccttttgtcgcaaacacaatattgagccaaggaatcctga |
124 |
Q |
|
|
||||||||| ||||| ||||||||||||||||| |||||||| |||||||| || ||||| ||||| | |||||| ||||| |
|
|
T |
41491900 |
aggccatggaagaggcagcaagttttgctgatttgtgggttccattttgtcggaagcacaacattgacctaaggaaccctga |
41491819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 42 - 134
Target Start/End: Complemental strand, 12194769 - 12194677
Alignment:
Q |
42 |
gaggccatggctgaggccgcaagttttgctgatttatgggttcccttttgtcgcaaacacaatattgagccaaggaatcctgattcttacttt |
134 |
Q |
|
|
||||||||||| ||||| ||||||||||| || || |||||||| |||||||| || ||| | ||||| |||||||| || || ||||||||| |
|
|
T |
12194769 |
gaggccatggccgaggcagcaagttttgcggagttgtgggttcctttttgtcggaagcacgacattgaaccaaggaacccggaatcttacttt |
12194677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 29919111 - 29918979
Alignment:
Q |
1 |
cttgttatgtttcagatgatggaggtgctcttttaacattcgaggccatggctgaggccgcaagttttgctgatttatgggttcccttttgtcgcaaaca |
100 |
Q |
|
|
|||| |||||||| |||||||| ||||| |||||||| || ||||| ||||||||||| || || ||||| || |||||||| || || |||||||| |
|
|
T |
29919111 |
cttgctatgtttctgatgatgggggtgcacttttaacttttgaggcaatggctgaggctgctagctttgccaataactgggttccattctgccgcaaaca |
29919012 |
T |
 |
Q |
101 |
caatattgagccaaggaatcctgattcttactt |
133 |
Q |
|
|
|||| ||||| ||||||||||| || ||||| |
|
|
T |
29919011 |
tgatatagagcctaggaatcctgaatcatactt |
29918979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 133
Target Start/End: Complemental strand, 15419432 - 15419374
Alignment:
Q |
75 |
ttatgggttcccttttgtcgcaaacacaatattgagccaaggaatcctgattcttactt |
133 |
Q |
|
|
|||||||| || |||||||| ||||||||||| || ||||||||||| ||| ||||||| |
|
|
T |
15419432 |
ttatgggtaccattttgtcgaaaacacaatatcgaaccaaggaatccagatgcttactt |
15419374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University