View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0964_low_59 (Length: 228)

Name: NF0964_low_59
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0964_low_59
NF0964_low_59
[»] chr1 (1 HSPs)
chr1 (154-228)||(2785119-2785193)
[»] chr5 (1 HSPs)
chr5 (154-228)||(22526021-22526098)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 154 - 228
Target Start/End: Complemental strand, 2785193 - 2785119
Alignment:
154 atggttggtgctggaaggggtcaaaactatgttcaagatcctgggcgcacacaaacagtttctcagggacaagtt 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
2785193 atggttggtgctggaaggggtcaaaactatgttcaagatcctgggcgctcacaaacagtttctcagggacaagtt 2785119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 228
Target Start/End: Original strand, 22526021 - 22526098
Alignment:
154 atggttggtgctggaaggggtcaaaactatgttcaagatcct---gggcgcacacaaacagtttctcagggacaagtt 228  Q
    |||||||||||||||| |||||||| ||||||||||| ||||   |||||| ||||||  ||||||||||||||||||    
22526021 atggttggtgctggaatgggtcaaacctatgttcaaggtcctggggggcgctcacaaatggtttctcagggacaagtt 22526098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University