View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_low_59 (Length: 228)
Name: NF0964_low_59
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_low_59 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 154 - 228
Target Start/End: Complemental strand, 2785193 - 2785119
Alignment:
| Q |
154 |
atggttggtgctggaaggggtcaaaactatgttcaagatcctgggcgcacacaaacagtttctcagggacaagtt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2785193 |
atggttggtgctggaaggggtcaaaactatgttcaagatcctgggcgctcacaaacagtttctcagggacaagtt |
2785119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 228
Target Start/End: Original strand, 22526021 - 22526098
Alignment:
| Q |
154 |
atggttggtgctggaaggggtcaaaactatgttcaagatcct---gggcgcacacaaacagtttctcagggacaagtt |
228 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| |||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
22526021 |
atggttggtgctggaatgggtcaaacctatgttcaaggtcctggggggcgctcacaaatggtttctcagggacaagtt |
22526098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University