View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_low_60 (Length: 228)
Name: NF0964_low_60
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_low_60 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 36465174 - 36465060
Alignment:
| Q |
1 |
tgacctgcctgtgattgactatgatttagcacttctttttcaaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465174 |
tgacctgcctgtgattgactatgatttagcacttctttttcaaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgac |
36465075 |
T |
|
| Q |
101 |
tggatgataacatct |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36465074 |
tggatgataacatct |
36465060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 36474352 - 36474241
Alignment:
| Q |
1 |
tgacctgcctgtgattgactatgatttagcacttctttttcaaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||| |
|
|
| T |
36474352 |
tgacctgcctgtgattgactatgatttagcacttcttttccaaccaatgttaatgcttggaatcagtcttggtgttgctttcaatctcattttccctgac |
36474253 |
T |
|
| Q |
101 |
tggatgataaca |
112 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
36474252 |
tggatgttaaca |
36474241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University