View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0964_low_67 (Length: 202)
Name: NF0964_low_67
Description: NF0964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0964_low_67 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 17 - 97
Target Start/End: Original strand, 6729372 - 6729452
Alignment:
| Q |
17 |
agtgagatgaagtgataacagtgtagagaaaggaataaaatttgttgaggtagagaatggggttgttgcagatccagtgaa |
97 |
Q |
| |
|
|||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6729372 |
agtgtgatgaagtgataacggtgtagagaaaagaataaaatttgttgaggtagagaatggggttgttgcagatctagtgaa |
6729452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University