View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0965_low_18 (Length: 345)
Name: NF0965_low_18
Description: NF0965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0965_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 9e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 82 - 317
Target Start/End: Complemental strand, 30847018 - 30846784
Alignment:
| Q |
82 |
aagattctcttaaatgatttttgagtaaaataaattttgatcagattttacttatttgtaggtcaaactttaaattatcaaatcattttctctgagaact |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30847018 |
aagattctcttaaatgatttttgagtaaaataaattttgatcagattttacttatttatatgtcaaactttaaattatcaaatcattttctatgagaact |
30846919 |
T |
 |
| Q |
182 |
ggagggttaaaaaattctcttaaattgatgattagattttctattttcaaatgttaaaatttgtttagagatattcacnnnnnnnngaaagattgtctag |
281 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
30846918 |
ggagggttaaaaaattttcttaaattgatgattagattttctattttcaaatgttaaaatttgtctagagatattca-aaaaaaaaaaaaaattgtctag |
30846820 |
T |
 |
| Q |
282 |
aggaaagtgggaaactgccaattaagtgggggaact |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30846819 |
aggaaagtgggaaactgccaattaagtgggggaact |
30846784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University