View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0965_low_25 (Length: 289)
Name: NF0965_low_25
Description: NF0965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0965_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 4893531 - 4893378
Alignment:
| Q |
1 |
catatctgttcgtctctctttaaatatgatggaaaaatataatttatagtaactcttgtgagacatgccccttgttagtaagatcttcacatttgtttgc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
4893531 |
catatctgttcgtctccctttaaatatgatgggaaaatataatttatagtaactcttgtgagacacgccccttgttagtaaggtcttcacatttgtttgc |
4893432 |
T |
 |
| Q |
101 |
ttctctttaaatataatatgatatgataggtaagagttctccatgaagaaagtt |
154 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4893431 |
ttctctttaaatatgatatgatatgataggtaagagttctccatgaagaaagtt |
4893378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 198 - 261
Target Start/End: Complemental strand, 4892991 - 4892928
Alignment:
| Q |
198 |
ttgtgattaattgatttttaaaaagtaaatcaaataatcaagaacaatatattggaaagtacct |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4892991 |
ttgtgattaattgatttttaaaaagtaaatcaattaatcaagaacaatatattggaaagtacct |
4892928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University