View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0965_low_30 (Length: 266)
Name: NF0965_low_30
Description: NF0965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0965_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 13 - 131
Target Start/End: Complemental strand, 4893496 - 4893378
Alignment:
Q |
13 |
aatataatttatagtaactcttgtgagacatgccccttgttagtaagatcttcacatttgtttgcttctctttaaatataatatgatatgataggtaaga |
112 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
4893496 |
aatataatttatagtaactcttgtgagacacgccccttgttagtaaggtcttcacatttgtttgcttctctttaaatatgatatgatatgataggtaaga |
4893397 |
T |
 |
Q |
113 |
gttctccatgaagaaagtt |
131 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
4893396 |
gttctccatgaagaaagtt |
4893378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 175 - 238
Target Start/End: Complemental strand, 4892991 - 4892928
Alignment:
Q |
175 |
ttgtgattaattgatttttaaaaagtaaatcaaataatcaagaacaatatattggaaagtacct |
238 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
4892991 |
ttgtgattaattgatttttaaaaagtaaatcaattaatcaagaacaatatattggaaagtacct |
4892928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University