View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0965_low_36 (Length: 232)

Name: NF0965_low_36
Description: NF0965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0965_low_36
NF0965_low_36
[»] chr5 (1 HSPs)
chr5 (29-131)||(14281385-14281487)


Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 29 - 131
Target Start/End: Complemental strand, 14281487 - 14281385
Alignment:
29 gagatgagatgagcttaacaaacataaaatggatgaagaaagagcgacgagtgtgaagttaccggcaaaaaacatggccaagtaaggagcgatttgttca 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||    
14281487 gagatgagatgagcttaacaaacataaaatggatgaagaaagagcaatgagtgtgaagttaccggcaaaaaacatggccaagtaaggagcgatttgttca 14281388  T
129 gtg 131  Q
    |||    
14281387 gtg 14281385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University