View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0965_low_36 (Length: 232)
Name: NF0965_low_36
Description: NF0965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0965_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 29 - 131
Target Start/End: Complemental strand, 14281487 - 14281385
Alignment:
| Q |
29 |
gagatgagatgagcttaacaaacataaaatggatgaagaaagagcgacgagtgtgaagttaccggcaaaaaacatggccaagtaaggagcgatttgttca |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14281487 |
gagatgagatgagcttaacaaacataaaatggatgaagaaagagcaatgagtgtgaagttaccggcaaaaaacatggccaagtaaggagcgatttgttca |
14281388 |
T |
 |
| Q |
129 |
gtg |
131 |
Q |
| |
|
||| |
|
|
| T |
14281387 |
gtg |
14281385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University