View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0966_high_4 (Length: 247)
Name: NF0966_high_4
Description: NF0966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0966_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 12627165 - 12627025
Alignment:
| Q |
17 |
gtccttgggtgtcagacacgcgtcggtgtctccgatacaccgacaccaacacgacacctataactagaccgaatattatgccattttctcacattattat |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12627165 |
gtccttgggtgtcagacatgcgtcggtgtctccgatacaccgacaccaaaacgacacctataactacaccgaatattatgccattttctcacattattat |
12627066 |
T |
 |
| Q |
117 |
ctgtgtccgtgtccgtgtcatatctactgtccatgtctgtc |
157 |
Q |
| |
|
||||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
12627065 |
ctgtgtcggtgtccgtgtcatgtctggtgtccatgtctgtc |
12627025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 167 - 198
Target Start/End: Complemental strand, 12626928 - 12626897
Alignment:
| Q |
167 |
agttcatattatattctgcacaacacttgctg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12626928 |
agttcatattatattctgcacaacacttgctg |
12626897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 137
Target Start/End: Original strand, 10230067 - 10230146
Alignment:
| Q |
56 |
ccgacaccaacacgacacctataactagaccgaatattatgccattttctcacattattatctgtgtccgtgtccgtgtcat |
137 |
Q |
| |
|
||||||||||||||||| ||||| || || |||| |||| ||||| |||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
10230067 |
ccgacaccaacacgacatctatacttacactgaat--tatgtcatttcctcaaattattatctgagtcagtgtccgtgtcat |
10230146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 135
Target Start/End: Original strand, 40747767 - 40747844
Alignment:
| Q |
56 |
ccgacaccaacacgacacctataactagaccgaatattatgccattttctcacattattatctgtgtccgtgtccgtgtc |
135 |
Q |
| |
|
|||||||||||| ||||||||||| || | || |||||| |||||||||| ||||||||| ||||| ||||| ||||| |
|
|
| T |
40747767 |
ccgacaccaacatgacacctataattacattga--attatgtcattttctcaaattattatccgtgtcggtgtctgtgtc |
40747844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University