View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0968_low_2 (Length: 382)
Name: NF0968_low_2
Description: NF0968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0968_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 139 - 294
Target Start/End: Original strand, 5739238 - 5739393
Alignment:
Q |
139 |
tgatgaattttggtgcaggtgtgtaatggggcattgttaagaaggaattatgtgactaaagatatcaactttggagttggggctcgtgctgccatgcttc |
238 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
5739238 |
tgatgaattttggtgcaggtgtgtaatggggcattgttaagaaggaattatgtgactaaagatatcaaatttggagttggggctcgtgctgccatgcttc |
5739337 |
T |
 |
Q |
239 |
aaggtgtttctgaggttgctgaggctgtcaaagttaccatgggacccaaggtattg |
294 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5739338 |
aaggtgtttctgaggttgctgaggctgtcaaagttaccatgggacccaaggtattg |
5739393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 345 - 373
Target Start/End: Original strand, 5739444 - 5739472
Alignment:
Q |
345 |
acagatacttgttatgttatgacctatga |
373 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
5739444 |
acagatacttgttatgttatgacctatga |
5739472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University