View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0968_low_7 (Length: 267)
Name: NF0968_low_7
Description: NF0968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0968_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 94 - 250
Target Start/End: Complemental strand, 34021260 - 34021104
Alignment:
| Q |
94 |
ccaactaagcatttatccatgaatttggagtttctttgcacactgcgaatcaaatgttcaaataacactcaaattcatgttttacaaaataaatcatgtt |
193 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34021260 |
ccaactaagcatttatccatggatttggagtttctttgcacactgcgaatcaaatgttcaaataacactcaaattcatgttttacaaaataaatcatgtt |
34021161 |
T |
 |
| Q |
194 |
acataaaataaacatgaataaatcagccaaatgagagaatatgtaactcctatgata |
250 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34021160 |
acataaaataagcatgaataaatcagacaaatgagagaatatgtaactcctatgata |
34021104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University