View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0971_low_3 (Length: 388)
Name: NF0971_low_3
Description: NF0971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0971_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 34675107 - 34675366
Alignment:
| Q |
1 |
gaaagttagaagataaatagattcatattttgtatgactcaatannnnnnn-attgctttgtagcgcaggagaaaaaatggcatcatcaagctcatacaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675107 |
gaaagttagaagataaatagattcatattttgtatgactcaatattttttttattgctttgtagcgcaggagaaaaaatggcatcatcaagctcatacaa |
34675206 |
T |
 |
| Q |
100 |
ttcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatactttccaccggaagaacctcaaaaatttgcaaac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675207 |
ttcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatactttccaccggaagaacctcaaaaatttgcaaac |
34675306 |
T |
 |
| Q |
200 |
gttcacaagatcttcggcgcaagcaacgtcacaaagatcctcaacgaactcctccctcac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675307 |
gttcacaagatcttcggcgcaagcaacgtcacaaagatcctcaacgaactcctccctcac |
34675366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 73 - 259
Target Start/End: Original strand, 43583166 - 43583355
Alignment:
| Q |
73 |
aaaaatggcatcatca---agctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatacttt |
169 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||| |||||||||||| | | |||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
43583166 |
aaaaatggcatcatcatccagctcatacaattcaccttgtgctgcctgcaaattcttgaggagaaaatgcatgccaggatgcatctttgcaccttacttc |
43583265 |
T |
 |
| Q |
170 |
ccaccggaagaacctcaaaaatttgcaaacgttcacaagatcttcggcgcaagcaacgtcacaaagatcctcaacgaactcctccctcac |
259 |
Q |
| |
|
|| || ||||| |||||||||||||||||||| ||||| || || || || ||||| ||||||||| | ||||| ||||| ||||||||| |
|
|
| T |
43583266 |
cctccagaagagcctcaaaaatttgcaaacgtgcacaaaatatttggtgctagcaatgtcacaaagcttctcaatgaacttctccctcac |
43583355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 137 - 225
Target Start/End: Complemental strand, 12360861 - 12360773
Alignment:
| Q |
137 |
tgcatgccaggctgcatctttgcaccatactttccaccggaagaacctcaaaaatttgcaaacgttcacaagatcttcggcgcaagcaa |
225 |
Q |
| |
|
|||||||||| ||||| ||||| ||||| || ||||| |||||||| |||||||||||||| |||||||| || || || |||||||| |
|
|
| T |
12360861 |
tgcatgccagattgcatatttgctccatatttcccaccagaagaaccacaaaaatttgcaaatgttcacaaaatatttggtgcaagcaa |
12360773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University