View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0971_low_6 (Length: 270)
Name: NF0971_low_6
Description: NF0971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0971_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 107 - 269
Target Start/End: Original strand, 25739462 - 25739624
Alignment:
| Q |
107 |
caactatatttttgtaaattgatgttatatgtgtccaacatcgtaggtatgtttaagattgttgtttgtgtgttaaagttcatgtctctcggttaaaatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
25739462 |
caactatatttttgtaaattgatgttatatatgtccaacatcgtaggtatgtttaaggttgttgtttgtgtgttaaagtccatgtctctcagttaaaatg |
25739561 |
T |
|
| Q |
207 |
tttaggatattttgtttttgcttctaaacctttgtttcatacattgatcaaattgttttctcg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25739562 |
tttaggatattttgtttttgcttctaaacctttgtttcatacattgatcaaattgttttctcg |
25739624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 138 - 268
Target Start/End: Original strand, 25743099 - 25743230
Alignment:
| Q |
138 |
tgtccaacatcgtaggtatgtttaagattgttgtttgtgtgttaaagttcatgtct--ctcggttaaaatgtttaggatattttgtttttgcttctaaac |
235 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| |||||||||||| ||| ||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
25743099 |
tgtccaacatcttaggtatgtttaaggttgttgtttgtgtgttcaagttcatgtctcactcagttaaaatgtttaagata-tttgtttttgcttctaaac |
25743197 |
T |
|
| Q |
236 |
ctttgtttcatacattgatcaaattgttttctc |
268 |
Q |
| |
|
||| ||||| || ||||||||||||||||||| |
|
|
| T |
25743198 |
ttttatttcagactttgatcaaattgttttctc |
25743230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University