View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0976_low_3 (Length: 330)
Name: NF0976_low_3
Description: NF0976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0976_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 86 - 233
Target Start/End: Original strand, 37174174 - 37174322
Alignment:
| Q |
86 |
atgaatgtgtgatgtattttcttgattgtttgtttcgtaattttgttataaatgtgagtgcaatgtattataa-nnnnnnnncttttaaaaatgtaaatt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37174174 |
atgaatgtgtgatgtattttcttgattgtttgtttcgtaattttgttataaatgtgagtgcaatgtattataatttttttttattttaaaaatgtaaatt |
37174273 |
T |
 |
| Q |
185 |
ctttaaaatatattagttgtggatatatgtgaatacttaacgatatatc |
233 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37174274 |
cttcaaaatatattagttgtggatatatgtgaatacttaacaatatatc |
37174322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University