View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0977-Insertion-17 (Length: 188)
Name: NF0977-Insertion-17
Description: NF0977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0977-Insertion-17 |
 |  |
|
[»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 2e-41; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 91 - 188
Target Start/End: Complemental strand, 31795666 - 31795569
Alignment:
Q |
91 |
atacaaagtgtgttgtgagattatatcggtggttgaagagcttcttgtcaacatgcaagttgcgccaaaagtttttcgcctaattttcgacatacgaa |
188 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||| |
|
|
T |
31795666 |
atacaaagtgtgttgtgagattatatcggtggttgaagagcttcttgtcaacatgcaagttgcaccaaaagtttttcgtctgattttcgacatacgaa |
31795569 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 7 - 101
Target Start/End: Complemental strand, 31795791 - 31795697
Alignment:
Q |
7 |
agtttgggctggagaaaatggatggaagaatcaattttggcttttgtattttcaattcaaggatgtgttgatacaatcaagattatacaaagtgt |
101 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||| |
|
|
T |
31795791 |
agtttgggttggagaaaatggatggaagaatcaattttggcttttgtattttcaactcaaggatgtgttgatacaatcaagattacacaaggtgt |
31795697 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 94 - 153
Target Start/End: Complemental strand, 22189869 - 22189810
Alignment:
Q |
94 |
caaagtgtgttgtgagattatatcggtggttgaagagcttcttgtcaacatgcaagttgc |
153 |
Q |
|
|
||||||||||| ||| ||||| | | ||||||||||||||| |||||||||| ||||||| |
|
|
T |
22189869 |
caaagtgtgttatgatattatgttgatggttgaagagcttcctgtcaacatggaagttgc |
22189810 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 7 - 95
Target Start/End: Complemental strand, 1604934 - 1604845
Alignment:
Q |
7 |
agtttgggctggagaaaatggatggaagaatcaattttggcttttgtat-tttcaattcaaggatgtgttgatacaatcaagattataca |
95 |
Q |
|
|
|||||||||| ||||||| || |||||||| ||||||| ||| || | |||||| ||||||| | ||| ||||||||||||||||||| |
|
|
T |
1604934 |
agtttgggctatagaaaattgaaggaagaatgaattttgacttgtggaaatttcaagtcaaggacgggttaatacaatcaagattataca |
1604845 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 94 - 182
Target Start/End: Original strand, 10149858 - 10149946
Alignment:
Q |
94 |
caaagtgtgttgtgagattatatcggtggttgaagagcttcttgtcaacatgcaagttgcgccaaaagtttttcgcctaattttcgaca |
182 |
Q |
|
|
|||| |||||| ||||||||| |||||||||||||| |||| | | |||| |||||| ||| ||||||||| ||| |||||||||| |
|
|
T |
10149858 |
caaattgtgttatgagattatgtcggtggttgaagaacttccggcccacataaaagttgtaccataagtttttcacctgattttcgaca |
10149946 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 9 - 96
Target Start/End: Original strand, 4529185 - 4529275
Alignment:
Q |
9 |
tttgggctggagaaaatggatggaagaatcaattttggcttttgt---attttcaattcaaggatgtgttgatacaatcaagattatacaa |
96 |
Q |
|
|
|||||||| |||||||| | ||||||||||||||||| ||| ||| ||||||| ||| |||||| | ||| |||||| |||||||||| |
|
|
T |
4529185 |
tttgggctagagaaaattggtggaagaatcaattttgccttgtgtggagttttcaagtcatggatgtttcgatccaatcacgattatacaa |
4529275 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University