View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0977-Insertion-18 (Length: 120)
Name: NF0977-Insertion-18
Description: NF0977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0977-Insertion-18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 3e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 3e-33
Query Start/End: Original strand, 9 - 116
Target Start/End: Complemental strand, 17571262 - 17571155
Alignment:
Q |
9 |
cttacagtcaagttcgatagagaccgaagaaaacctcaaattactaagctagtttatcgtttttgttaaacatattatcgcttcttgtcaaagcaaaggc |
108 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| || | || || ||||||||||||||| ||||||||||||| |
|
|
T |
17571262 |
cttacagttaagttcgatagagaccgaagaaaacctcaaattactaagttagtttatcgcttcttttgaatatattatcgcttcttttcaaagcaaaggc |
17571163 |
T |
 |
Q |
109 |
aacaaagt |
116 |
Q |
|
|
| |||||| |
|
|
T |
17571162 |
atcaaagt |
17571155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University