View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0977-Insertion-5 (Length: 228)
Name: NF0977-Insertion-5
Description: NF0977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0977-Insertion-5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 79 - 228
Target Start/End: Complemental strand, 16964805 - 16964653
Alignment:
| Q |
79 |
ctgctctcttcttctacactccatttctcattgaataacacaacaatacaccaagaacaacacatcatcccaacaatccagcaataaatcatcgatgtta |
178 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16964805 |
ctgctctattcttctacactccatttctcattgaataacacaacaatacaccaagaacaacacagcatcccaacaatccagcaacaaatcatcgatgtta |
16964706 |
T |
 |
| Q |
179 |
atcca---acaacaacaaattcaaaaaattctttatcaaaccttcatcccttc |
228 |
Q |
| |
|
||||| |||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
16964705 |
atccaacgacaacaacaaatccagaaaattctttatcaaaccttcatcacttc |
16964653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University