View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0978_low_4 (Length: 304)
Name: NF0978_low_4
Description: NF0978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0978_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 76 - 253
Target Start/End: Complemental strand, 42639360 - 42639183
Alignment:
| Q |
76 |
cgttgaatatgaagaatcagccactcaaccaccggaaaccacaaaaacttcatcacttgtccgatacaattcgcctctttcacaaatcatccttattgga |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42639360 |
cgttgaatatgaagaatcagccactcaaccaccgaaaaccacaaaaacttcatcacttgtccgatacaattcgcctctttcacaaatcatccttattgga |
42639261 |
T |
 |
| Q |
176 |
ttggtttgtttttgttgtccaggcatgttcaatgctctttcaggaatgggtggtggtggtcaagtcaatgcaacagct |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42639260 |
ttggtttgtttttgttgtccaggcatgttcaatgctctttcaggaatgggtggtggtggtcaagtcaatgcaacagct |
42639183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 79 - 253
Target Start/End: Complemental strand, 42632216 - 42632039
Alignment:
| Q |
79 |
tgaatatgaagaatcagccactcaaccaccggaaaccacaaaaacttcatcac---ttgtccgatacaattcgcctctttcacaaatcatccttattgga |
175 |
Q |
| |
|
|||| ||| |||||||| |||||| |||| ||||| |||||||||||||||| || || |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
42632216 |
tgaaaatgtagaatcaggaactcaaacaccagaaacaacaaaaacttcatcacaccttttcagatacaattcacctctttcacaaataatccttattggc |
42632117 |
T |
 |
| Q |
176 |
ttggtttgtttttgttgtccaggcatgttcaatgctctttcaggaatgggtggtggtggtcaagtcaatgcaacagct |
253 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42632116 |
ttagtttgtttttgttgtccaggcatgttcaacgctctttcaggaatgggtggtggtggtcaagtcaatgcaacagct |
42632039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University