View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0979-INSERTION-11 (Length: 99)
Name: NF0979-INSERTION-11
Description: NF0979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0979-INSERTION-11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 7e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 7e-43
Query Start/End: Original strand, 8 - 95
Target Start/End: Original strand, 34489530 - 34489617
Alignment:
| Q |
8 |
aaacaagtaattacttaatgcgcgtgttgcgtgaagttctatcttcgaatcgaatggcgtaacctacttcttctccaagctgaacacc |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34489530 |
aaacaagtaattacttaatgcgcgtgttgcgtgaagttctatcttcgaatcgaatggcgtaacctacttcttctccaagctgaacacc |
34489617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University