View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0979-INSERTION-48 (Length: 407)
Name: NF0979-INSERTION-48
Description: NF0979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0979-INSERTION-48 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 7 - 406
Target Start/End: Original strand, 785770 - 786175
Alignment:
| Q |
7 |
aacatcttcttattactcttcttctatttgaaatccagcaaaactaagatgatgattgaagatggagggatatttgtgttactggttttgaaatttagtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785770 |
aacatcttcttattactcttcttctatttgaaatccagcaaaactaagatgatgattgaagatggagggatatttgtgttactggttttgaaatttagtg |
785869 |
T |
 |
| Q |
107 |
ctacgtaccacaacctttgaaccactctcttcctttactacatttttctactcaatgcctttgattttggtttctaatatatagacactattggtaaacc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785870 |
ctacgtaccacaacctttgaaccactctcttcctttactacatttttctactcaatgcctttgattttggtttctaatatatagacactattggtaaacc |
785969 |
T |
 |
| Q |
207 |
tttgtaaccatgggatatgtttatgattgatttctttga------ggcaaaagttttggatttggtagagatggaaaaggaaatggttggcttcactttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785970 |
tttgtaaccatgggatatgtttatgattgatttctttgaggctttggcaaaagttttggatttggtagagatggaaaaggaaatggttggcttcactttt |
786069 |
T |
 |
| Q |
301 |
ggtttgtgtatgcatttgggcaaagatttagccactttcggcaaaacaaagtataggaggaagtgtgcaagcatggctaaagaaaactgatgattttact |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
786070 |
ggtttgtgtatgcatttgggcaaagatttagccactttcggcaaaacaaagtataggaggaagtgtgcaagcatggctaaagaaaactgatgattttact |
786169 |
T |
 |
| Q |
401 |
gaaaga |
406 |
Q |
| |
|
|||||| |
|
|
| T |
786170 |
gaaaga |
786175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University