View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0979-INSERTION-50 (Length: 348)
Name: NF0979-INSERTION-50
Description: NF0979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0979-INSERTION-50 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 9 - 348
Target Start/End: Complemental strand, 38571750 - 38571411
Alignment:
| Q |
9 |
atactacctcatttatcacccttcaccgagcatcttaacttattggtgagtcattttacctggatgctagctagtnnnnnnnaaatacttttccttcttc |
108 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
38571750 |
atactacctcatttatcacccttctccgagcatcttaacttattggtgagtcgttttacctgcatgctagctagtgggggggaaatacttttccttcttc |
38571651 |
T |
|
| Q |
109 |
atatacacaatattctaacgtagaacaaaataaaataagatcaatattaaaatctatattcttataagcagtcctagcgttttctgaccagggattatgg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
38571650 |
atatacacaatattctaacgtagaacaaaataaaatatgatcaatattaaaatctatattcttataagcagacctagcgttttctgaccaggaattatgg |
38571551 |
T |
|
| Q |
209 |
tctgaaaatcataacccggtagaaccaacagagttcgttcaagtactcaattcaataccattgtcgtgcctcagaatatacacaaacatatgaacgattt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38571550 |
tctgaaaatcataacccggtagaaccaacagagttcgtttaagtactcaattcaataccattgtcgtgcctcagaatatacacaaacatatgaacgattt |
38571451 |
T |
|
| Q |
309 |
tacccttagctaccaaataaagctagggcatagcatttac |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38571450 |
tacccttagctaccaaataaagctagggcatagcatttac |
38571411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 9e-24; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 8 - 80
Target Start/End: Complemental strand, 18567824 - 18567752
Alignment:
| Q |
8 |
catactacctcatttatcacccttcaccgagcatcttaacttattggtgagtcattttacctggatgctagct |
80 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
18567824 |
catactacctcatttatcacccttcatcgagtatcttaacttattggtgagtcgttttacctgcatgctagct |
18567752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 18634104 - 18634176
Alignment:
| Q |
8 |
catactacctcatttatcacccttcaccgagcatcttaacttattggtgagtcattttacctggatgctagct |
80 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
18634104 |
catactacgtcatttatcacccttcaccgagtatcttaacttattggtgagtcgttttacctgcatgctagct |
18634176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 18635037 - 18635109
Alignment:
| Q |
8 |
catactacctcatttatcacccttcaccgagcatcttaacttattggtgagtcattttacctggatgctagct |
80 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
18635037 |
catactacgtcatttatcacccttcaccgagtatcttaacttattggtgagtcgttttacctgcatgctagct |
18635109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 18624361 - 18624433
Alignment:
| Q |
8 |
catactacctcatttatcacccttcaccgagcatcttaacttattggtgagtcattttacctggatgctagct |
80 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
18624361 |
catactacatcatctatcacccttcaccgagtatcttaacttattggtgagtcgttttacctgcatgctagct |
18624433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 18649384 - 18649456
Alignment:
| Q |
8 |
catactacctcatttatcacccttcaccgagcatcttaacttattggtgagtcattttacctggatgctagct |
80 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||| |||| |||||| ||||||||| || |||||| |
|
|
| T |
18649384 |
catactacgtcatttatcacccttcaccgagtatcttaactaattgctgagtcgttttacctgcattctagct |
18649456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University