View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0979-INSERTION-53 (Length: 218)
Name: NF0979-INSERTION-53
Description: NF0979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0979-INSERTION-53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 7 - 214
Target Start/End: Original strand, 42068270 - 42068482
Alignment:
| Q |
7 |
agtaaatagtgttgttgattggtcaattggcaaactatactcagaatcaatactac--tctctatcttctatcacccctcaagtgggttgtatttttgtt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42068270 |
agtaaatagtgttgttgattggtcaattggcaaactatactcagaatcaatactaccctctctatcttctatcacccctcaagtgggttgtatttttgtt |
42068369 |
T |
|
| Q |
105 |
tgctcatgaagggag---ctcgggttccacgttgaatcaagggcaaccatataaatgatttaaacataatattttaacgtaaaatcttaatacattttgt |
201 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
42068370 |
tgatcatgaagggaggagctcgggttccacgttgaatcaagggcaatcatataaatgagttaaacataatattttaacgtaaaatcttaagatattttgt |
42068469 |
T |
|
| Q |
202 |
atatgggtcatct |
214 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42068470 |
atatgggtcatct |
42068482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University