View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0979-INSERTION-54 (Length: 247)
Name: NF0979-INSERTION-54
Description: NF0979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0979-INSERTION-54 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 247
Target Start/End: Complemental strand, 2719439 - 2719210
Alignment:
| Q |
8 |
tatagctggtgtgatgtgaacactacacgtatataaaattgcacacatatcgttaaaatagtaacttcggtccaaaagtaatttgattatgaagttcggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2719439 |
tatagctggtgtgatgtgaacactacacgtatataaaattgcacacatatcgttaaaatagtaacttcggtccaaaagtaatttgattatgaacttcggt |
2719340 |
T |
|
| Q |
108 |
caattgtgcttatgtcttcgatagtagagtatttaccataactttgcattatttaaacttaaggtttaaataatgcaacttgtaactaaatataaatact |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
2719339 |
caattgtgcttatgtcttcgatagtagagtatttaccataactttgcattatttaaacttagggtttaaataatgcaacttg----------taaatact |
2719250 |
T |
|
| Q |
208 |
acgatccagtttacgatcgatgtatcctgtatattattcc |
247 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2719249 |
acgatccagtttacgatcgatgtatactgtatattattcc |
2719210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University