View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0979-INSERTION-57 (Length: 275)
Name: NF0979-INSERTION-57
Description: NF0979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0979-INSERTION-57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 27 - 255
Target Start/End: Complemental strand, 39788403 - 39788175
Alignment:
| Q |
27 |
aaatgactaaccgattccaccggagaaccataaaacacacacaaggcatcactataatttacaaaggacacacattatgtgactatgatcaatcaaattt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39788403 |
aaatgactaaccgattccaccggagaaccataaaacacacacaaggcatcactataatttacaaaggacacacattatgtgactatgattaatcaaattt |
39788304 |
T |
|
| Q |
127 |
agacttttcattatatctgaatcgattaaaataaaaactgcaaatcacacaaggattaagagtttgtccaagaggtgtcagctctgtagtgagaacttgg |
226 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39788303 |
agacttgtcattatatctgaatcgattaaaataaaaactgcaaatcacacaaggattaagagtttgtccaagaggtgtcagctctgtagtgagaacttgg |
39788204 |
T |
|
| Q |
227 |
tcttataatatcaacagatgaactccaaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39788203 |
tcttataatatcaacagatgaactccaaa |
39788175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University