View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0979-INSERTION-60 (Length: 266)
Name: NF0979-INSERTION-60
Description: NF0979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0979-INSERTION-60 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 8 - 266
Target Start/End: Original strand, 36211145 - 36211403
Alignment:
| Q |
8 |
atgataacaattactactgcagccacaattccaacaacagctcctatagatatgctgcttccattttcagaaggagctggaaaatctgcaagattattag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36211145 |
atgataacaattactactgcagccacaattccaacaacagctcctatagatatgctgcttccattttcagaaggagctggaaaatctgcaagattattag |
36211244 |
T |
 |
| Q |
108 |
gcaatggtttgatcagatcacaacatggagatggttttaaatagcggtatgcaacagtaattgcgaccgcaatataaaggattttgaggtatctgtaaca |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36211245 |
gcaatagtttgatcagatcacaacatggagatggttttaaattgcggtatgcaacaataattgcgaccgcaatataaaggattttgaggtatctgtaaca |
36211344 |
T |
 |
| Q |
208 |
gattcgcaactgaaatttcaatcacatcggccacattttttcacaatttaaagcaatac |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36211345 |
gattcgcaactgaaatttcaatcacatcggccacattttttcacaatttaaagcaatac |
36211403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University