View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0979-INSERTION-63 (Length: 170)
Name: NF0979-INSERTION-63
Description: NF0979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0979-INSERTION-63 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 3e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 3e-40
Query Start/End: Original strand, 75 - 170
Target Start/End: Original strand, 27567538 - 27567632
Alignment:
| Q |
75 |
ccatgtattaatcattcctgcggaaatagggaatgtttcatgaatgagaatgttaatgacacaatattttgttgaaacacatagctttcccaaatc |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27567538 |
ccatgtattaatcattcctgcggaaatagggaatgtttcctgaatgagaatgttaatgacacaatattttgttgaaacacatagc-ttcccaaatc |
27567632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 7 - 35
Target Start/End: Original strand, 27567470 - 27567498
Alignment:
| Q |
7 |
atagttgaggctaatttgtacagagcgca |
35 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27567470 |
atagttgaggctaatttgtacagagcgca |
27567498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University