View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0979-INSERTION-64 (Length: 118)
Name: NF0979-INSERTION-64
Description: NF0979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0979-INSERTION-64 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 2e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 20670073 - 20669963
Alignment:
| Q |
8 |
tagtttgattgagaacatgagttaaaggggttccaaagtagaagttacatactctccagggacttctccagtcaagtactcagggatctcagatctgtcc |
107 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20670073 |
tagtttgattgagaaaatgagttaaaggagttccaaagtagaagtcacatactctccagggacttctccagtcaagtactcagggatctcagatctgtcc |
20669974 |
T |
|
| Q |
108 |
aagagaccgtc |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
20669973 |
aagagaccgtc |
20669963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University