View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0979-INSERTION-66 (Length: 195)
Name: NF0979-INSERTION-66
Description: NF0979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0979-INSERTION-66 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 8 - 195
Target Start/End: Original strand, 45303844 - 45304025
Alignment:
| Q |
8 |
agaaccaccagtgaagtttgagccacaggagtatatacacgtatgaattacatattttcaatcatgtataattaattctgaacagggaggtaatgtacca |
107 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45303844 |
agaaccacctgtgaagtttgagccacaagagtatatacacgtatgaattacatattttcaatcatgtataattaattctgaacagggaggtaatgtacca |
45303943 |
T |
 |
| Q |
108 |
ctcagaataattagaaccttacgaaactctttacttttgcagttttgcttctgttttttgccaaatcatacgtctttacgtagtgcat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45303944 |
ctcagaataattagaaccttacgaaactctttacttttgcagttttgcttc------ttgccaaatcatacgtctttacgtagtgcat |
45304025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University