View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0980-21 (Length: 186)
Name: NF0980-21
Description: NF0980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0980-21 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 88 - 186
Target Start/End: Original strand, 4529376 - 4529475
Alignment:
| Q |
88 |
gtatactgcagtgctaattgctattgatgataagtttt-atgataatccagtgataaatttacttcctattttatatttttaggtcaaaataaaaataat |
186 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4529376 |
gtataccgcagtgctaattgctattgatgataagtttttatgataatccagtgataaatttacttcctattttatatttttaggtcaaaataaaaataat |
4529475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 7 - 90
Target Start/End: Original strand, 4528985 - 4529068
Alignment:
| Q |
7 |
acttttaacccctaaacttatccactcattcaactgaatttaccgtgataaaaattattgaagcagtaattatttttaagggta |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4528985 |
acttttaacccctaaacttatccactcattcaactgaatttaccgtgataaaaattattgaagcagtaattatttttaagggta |
4529068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University