View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0980-23 (Length: 149)
Name: NF0980-23
Description: NF0980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0980-23 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 8e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 8e-47
Query Start/End: Original strand, 28 - 149
Target Start/End: Original strand, 26943663 - 26943778
Alignment:
| Q |
28 |
tcttacaaaatatattaaataaagataaaantatgtaggaaatttcctcttaccatcctcaagagaattgtagtaggcgtggctctcatttttgcgattt |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26943663 |
tcttacaaaatatattaaataaagatag------gtaggaaatttcctcttaccatcctcaagagaattgtagtaggcgtggctctcatttttgcgattt |
26943756 |
T |
|
| Q |
128 |
ggacttattatatttctttcat |
149 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26943757 |
ggacttattatatttctttcat |
26943778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University