View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0980-24 (Length: 202)
Name: NF0980-24
Description: NF0980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0980-24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 8 - 194
Target Start/End: Complemental strand, 34890115 - 34889926
Alignment:
| Q |
8 |
gagtgaatgataaactaacctttgtgggacacatcctcatccccaataattgcaaaatgtcataccagatgtgttcggaatt----ggtagagaaggatg |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
34890115 |
gagtgaatgataaactaaactttgtgggacacatcctcatccccaataattgaaaaatgtcatac-agatgtgttcggaattaattggtagagaaggatg |
34890017 |
T |
 |
| Q |
104 |
cttgtgactcttacttgctatctttccacgcaattatatggtatgataaacaaataggattgctgtttttattggagcaatctatcgtttt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
34890016 |
cttgtgactcttacttgctatctttccacgcaattatatggtatgataaacaaatagcattgttgtttttattggagcaatctatcgtttt |
34889926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University