View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0980-26 (Length: 56)
Name: NF0980-26
Description: NF0980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0980-26 |
 |  |
|
[»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 51; Significance: 4e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 4e-21
Query Start/End: Original strand, 2 - 56
Target Start/End: Original strand, 42628464 - 42628518
Alignment:
Q |
2 |
ccaacacgagtctgaactgtggttggcttagcaccatcacattcaagtcgaccat |
56 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
42628464 |
ccaacacgagtctgaactgtagttggcttagcaccatcacattcaagtcgaccat |
42628518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 2 - 56
Target Start/End: Original strand, 42639063 - 42639117
Alignment:
Q |
2 |
ccaacacgagtctgaactgtggttggcttagcaccatcacattcaagtcgaccat |
56 |
Q |
|
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
T |
42639063 |
ccaacacgagtctgaactgtggatgggttagcaccatcacattcaagtcgaccat |
42639117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University