View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0980-28 (Length: 369)
Name: NF0980-28
Description: NF0980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0980-28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 23 - 151
Target Start/End: Complemental strand, 18808554 - 18808426
Alignment:
| Q |
23 |
atgttcaacttaactaacactaagttgcgtccgatggacgctagtgactttgaagatttttgcgtccaattttccaatcgcagtgttgactcttttctga |
122 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18808554 |
atgttcaacttaactaacactaagtagcgtccgatggacgctagtgactttgaagatttttgcgtccaattttccaatcgcagtgttgactcttttctga |
18808455 |
T |
 |
| Q |
123 |
tgctaaaacacttgtttcttgtgatnttt |
151 |
Q |
| |
|
||||||||||||||||||||||||| ||| |
|
|
| T |
18808454 |
tgctaaaacacttgtttcttgtgatcttt |
18808426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University