View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0980-3 (Length: 183)
Name: NF0980-3
Description: NF0980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0980-3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 9e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 9e-75
Query Start/End: Original strand, 16 - 180
Target Start/End: Complemental strand, 27109312 - 27109150
Alignment:
| Q |
16 |
ttcctatagtgagctttgaaagatgatcagagatccagagaagataatgtaggataatatttgactagacttaggataatcatgcctctttctcaatttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27109312 |
ttcctatagtgagctttgaaagatgatcagagatccacagaagataatgtaggataatatttgactagacttcggataatcatgcctctttctcaatttt |
27109213 |
T |
|
| Q |
116 |
acaaaaagaattaaaagggttaacacagaagaaaaagaaaccaagttgccatgggatgcaggacc |
180 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27109212 |
acaaaaagaatt--aagggttaagacagaagaaaaagaaaccaagttgccatgggatgcaggacc |
27109150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University