View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0980-6 (Length: 217)
Name: NF0980-6
Description: NF0980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0980-6 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 217
Target Start/End: Original strand, 49085970 - 49086173
Alignment:
Q |
14 |
gccaagatcctgcttttagctggaagaattgcatttgtaggaatgatttcgtccgttcttacattatttctgtgccnnnnnnngagtagaatataagcac |
113 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
49085970 |
gccaagatcctgcttttagctggaagaattgcatttgcaggaatgatttcgtccgttcttacattatttctgtgcctttttttgagtagaatataagcaa |
49086069 |
T |
 |
Q |
114 |
gattcataaaatatactcccaaattgtattttatcattcaaaaagattttttaaataacgcttcgaaacattgatgaattctgctactgtaatcatttgg |
213 |
Q |
|
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
T |
49086070 |
gattcataaaatatgctctaaaattgtattttatcattcaaaaagattttttaaataacgcttcgaaacattgatgaattctgcttctgtaaccatttgg |
49086169 |
T |
 |
Q |
214 |
ggat |
217 |
Q |
|
|
|||| |
|
|
T |
49086170 |
ggat |
49086173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University