View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0980-8 (Length: 120)
Name: NF0980-8
Description: NF0980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0980-8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 10 - 120
Target Start/End: Original strand, 38125055 - 38125165
Alignment:
| Q |
10 |
aagtccagaaatactgttatgaaaaagaagatacagtttgcaagagaaaagcttgaaatgaaaaaagcttttatactatattaccaagtaagaggtaaac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
38125055 |
aagtccagaaatactgttatgaaaaagaagatacagtttgcaagagaaaagcttgaaatgaaaaaagcttttatattatattaccaagtaagaagtaaac |
38125154 |
T |
 |
| Q |
110 |
ctaattttgat |
120 |
Q |
| |
|
||||||||||| |
|
|
| T |
38125155 |
ctaattttgat |
38125165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University