View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0980_low_3 (Length: 440)
Name: NF0980_low_3
Description: NF0980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0980_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 6e-81; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 66 - 230
Target Start/End: Complemental strand, 28280800 - 28280637
Alignment:
| Q |
66 |
gtttcctgaaaaatatttagacaaagataaggaattcgaaagttgtttggcgaggggtgattggcatctacctagagctggcacataatagatgggtata |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28280800 |
gtttcctgaaaaatatttagacaaagataaggaattcgaaagttgtttggcgaggggtgattggcatctacctagagctggcacataatagatgggtata |
28280701 |
T |
 |
| Q |
166 |
actatggtggtagcaatagaagaccaacctaaatgatatttatacaattatttttagaacaattt |
230 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28280700 |
actatggtggtagcaatggaagaccaacctaaatgatatttatacaattattttta-aacaattt |
28280637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 356 - 430
Target Start/End: Original strand, 28295875 - 28295949
Alignment:
| Q |
356 |
aagacaaaagcccgctacatatgcatccagtggtttgactttgaggtccacacaaacatatcccatgaccctatg |
430 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
28295875 |
aagacaaaagcctgctacatatgcatccagtagtttgactttgaggtcaacacaaacatatcccatgactctatg |
28295949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 356 - 430
Target Start/End: Complemental strand, 28280492 - 28280419
Alignment:
| Q |
356 |
aagacaaaagcccgctacatatgcatccagtggtttgactttgaggtccacacaaacatatcccatgaccctatg |
430 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
28280492 |
aagacaaaagcctgctacatatgcatccagtagtttgactttgaggtcaacacaaacata-cccatgactctatg |
28280419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University