View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0982_low_4 (Length: 300)
Name: NF0982_low_4
Description: NF0982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0982_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 33 - 252
Target Start/End: Complemental strand, 18944008 - 18943789
Alignment:
Q |
33 |
aaacttgttattctttgggtgcaactacagagactaatcactcgtcagataagacctctgtgaatgccaaaacatatttaaaactgctgcgtttctaacg |
132 |
Q |
|
|
||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
18944008 |
aaacttgttatcctttgagtgcaactacagagactaatcgctcgtcagataagacctctgtgaatgccaaaacatatttaaaactgctgcatttctaacg |
18943909 |
T |
 |
Q |
133 |
ttagatttgaacccatacttgtaattaagcttaaaagatcatttgtcatctcattcagatgcttttggtaaacctgctctttgaaatgatggatcggaga |
232 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||| |
|
|
T |
18943908 |
ttagatttgaacccatacctgtaattaagcttaaaagatcatttgtcatctcattcaaatgcttttggtaaacctgctcttggaaatgacggatcggaga |
18943809 |
T |
 |
Q |
233 |
agtacattttccttgtattt |
252 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
18943808 |
agtacattttccttgtattt |
18943789 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University