View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0983_low_3 (Length: 223)
Name: NF0983_low_3
Description: NF0983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0983_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 4611247 - 4611040
Alignment:
| Q |
1 |
aaaacaataattttttacaaaatgatcatttattaaaggacggaatgagtagcaaatcaattnnnnnnnttgagtatagactgaagttgcaaaatttaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| || |||||||||| ||| ||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
4611247 |
aaaacaataattttttacaaaatgatcacttattaaagtacagaatgagtagtaaaacaattaaaaaaaatgagtatagattgaagttgcaaaatttaac |
4611148 |
T |
 |
| Q |
101 |
tctatgaaattttttatgcttgacatataattattcaattgcatatacttaaaccatttaagatttgccagaatcacaacttaaatttaggaactcttgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4611147 |
tctatgaaattttttatgcttgacatataattaatcaattgcatatacttaaaccatttaagatttgccagaatcacaacttaaatttaggaactcttgc |
4611048 |
T |
 |
| Q |
201 |
tgatgatg |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
4611047 |
tgatgatg |
4611040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 207
Target Start/End: Original strand, 4515685 - 4515747
Alignment:
| Q |
145 |
atacttaaaccatttaagatttgccagaatcacaacttaaatttaggaactcttgctgatgat |
207 |
Q |
| |
|
||||| ||| ||||||||||| |||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
4515685 |
atactcaaaacatttaagattagccagaatcacaacttcagtttaggaactccagctgatgat |
4515747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University