View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0983_low_3 (Length: 223)

Name: NF0983_low_3
Description: NF0983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0983_low_3
NF0983_low_3
[»] chr6 (2 HSPs)
chr6 (1-208)||(4611040-4611247)
chr6 (145-207)||(4515685-4515747)


Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 4611247 - 4611040
Alignment:
1 aaaacaataattttttacaaaatgatcatttattaaaggacggaatgagtagcaaatcaattnnnnnnnttgagtatagactgaagttgcaaaatttaac 100  Q
    |||||||||||||||||||||||||||| ||||||||| || |||||||||| ||| |||||        |||||||||| |||||||||||||||||||    
4611247 aaaacaataattttttacaaaatgatcacttattaaagtacagaatgagtagtaaaacaattaaaaaaaatgagtatagattgaagttgcaaaatttaac 4611148  T
101 tctatgaaattttttatgcttgacatataattattcaattgcatatacttaaaccatttaagatttgccagaatcacaacttaaatttaggaactcttgc 200  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4611147 tctatgaaattttttatgcttgacatataattaatcaattgcatatacttaaaccatttaagatttgccagaatcacaacttaaatttaggaactcttgc 4611048  T
201 tgatgatg 208  Q
    ||||||||    
4611047 tgatgatg 4611040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 145 - 207
Target Start/End: Original strand, 4515685 - 4515747
Alignment:
145 atacttaaaccatttaagatttgccagaatcacaacttaaatttaggaactcttgctgatgat 207  Q
    ||||| ||| ||||||||||| |||||||||||||||| | |||||||||||  |||||||||    
4515685 atactcaaaacatttaagattagccagaatcacaacttcagtttaggaactccagctgatgat 4515747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University