View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0984-Insertion-12 (Length: 259)
Name: NF0984-Insertion-12
Description: NF0984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0984-Insertion-12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 7 - 259
Target Start/End: Complemental strand, 28156525 - 28156273
Alignment:
| Q |
7 |
aacagaaaccggaaactgaccggagaaatgattatcattaagatatagagatttgagattaacaagatttgagagattaggaatttgacccgaaagtgag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
28156525 |
aacagaaaccggaaactgaccggagaaatcattatcattaagatatagagatttgagattaacaagatttgaaagattaggaatttgacccgaaagcgag |
28156426 |
T |
 |
| Q |
107 |
tttcctttgaaactaagaactcgaagttgatccaaacggtttaaaatgtttgaatctaatttcccagttaagttgaaatattcgagtactagctttctaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28156425 |
tttcctttgaaactaagaactcgaagttgatccaaacggtttaaaatgtttgaatctaatttcccagttaagttgaaatattcgagtactagctttctaa |
28156326 |
T |
 |
| Q |
207 |
ctttgcctttgtaacaatctttaactcccacccaagtgcaaacatcattgttc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28156325 |
ctttgcctttgtaacaatctttaactcccacccaagtgcaaacatcatcgttc |
28156273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University