View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0984-Insertion-16 (Length: 164)
Name: NF0984-Insertion-16
Description: NF0984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0984-Insertion-16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 12 - 164
Target Start/End: Original strand, 28756880 - 28757030
Alignment:
| Q |
12 |
gttagtccttctatggtggtggtttttcgaaatatagtctatgtggtgttcaagatctaaaaaagaatatgataaattaatagtgcaaaataaaaagaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||| |
|
|
| T |
28756880 |
gttagtccttctatggtggtggtttttcgaaatatagcctatgtggtgttcaagatctaaaaaagaatatgatgaattaaaagtgcaaaataaaa--aaa |
28756977 |
T |
 |
| Q |
112 |
caatggtttgttgatctatttggcagaaaacgtaaagtttgatgagaggatta |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28756978 |
caatggtttgttgatctatttggcagaaaacgtaaagtttgatgagaggatta |
28757030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University