View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0984-Insertion-16 (Length: 164)

Name: NF0984-Insertion-16
Description: NF0984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0984-Insertion-16
NF0984-Insertion-16
[»] chr2 (1 HSPs)
chr2 (12-164)||(28756880-28757030)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 12 - 164
Target Start/End: Original strand, 28756880 - 28757030
Alignment:
Q  12 gttagtccttctatggtggtggtttttcgaaatatagtctatgtggtgttcaagatctaaaaaagaatatgataaattaatagtgcaaaataaaaagaaa 111  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||  |||    
T  28756880 gttagtccttctatggtggtggtttttcgaaatatagcctatgtggtgttcaagatctaaaaaagaatatgatgaattaaaagtgcaaaataaaa--aaa 28756977  T
Q  112 caatggtttgttgatctatttggcagaaaacgtaaagtttgatgagaggatta 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28756978 caatggtttgttgatctatttggcagaaaacgtaaagtttgatgagaggatta 28757030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University