View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0984-Insertion-17 (Length: 134)
Name: NF0984-Insertion-17
Description: NF0984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0984-Insertion-17 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 43461795 - 43461921
Alignment:
Q |
8 |
gttttttattgatatattttagcaaatgagacttttgagaaggttgcaaatgtaggacttcatgtgaacatggttttgtacctgctaaacgagtatcatg |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43461795 |
gttttttattgatatattttagcaaatgagacttttgagaaggttgcaaatgtaggacttcatgtgaacatggttttgtacctgctaaacgagtatcatg |
43461894 |
T |
 |
Q |
108 |
cagagccttcaactgcggctatcataa |
134 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
43461895 |
cagagccttcaactgcggctatcataa |
43461921 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University