View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0984-Insertion-18 (Length: 120)
Name: NF0984-Insertion-18
Description: NF0984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0984-Insertion-18 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 4e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 39662964 - 39662856
Alignment:
Q |
8 |
agtttctgtcacatatatagcataaaacaagactcttttatatatggttgttgatatggtttgtttctcaggtaaggttagaattttctgctcaaattat |
107 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39662964 |
agtttctgtcacatatatagcataaaacaagtctcttttat----ggttgttgatatggtttgtttctcaggtaaggttagaattttctgctcaaattat |
39662869 |
T |
 |
Q |
108 |
tagctcttgtata |
120 |
Q |
|
|
||||||||||||| |
|
|
T |
39662868 |
tagctcttgtata |
39662856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University