View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0984-Insertion-19 (Length: 96)
Name: NF0984-Insertion-19
Description: NF0984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0984-Insertion-19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 42600297 - 42600212
Alignment:
| Q |
8 |
aaagattcgatggcattgattgtgttgtcgagacttgacacgtttacgttgtggtttatgatttggaagaatccccatgttttggc |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600297 |
aaagattcgatggcattgattgtgttgtcgagacttgacacgtttacgttgtggtttatgatttggaagaatccccatgttttggc |
42600212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University