View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0984-Insertion-20 (Length: 85)
Name: NF0984-Insertion-20
Description: NF0984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0984-Insertion-20 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 1e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 17 - 85
Target Start/End: Original strand, 28259009 - 28259077
Alignment:
Q |
17 |
tcaagtagtcaaaatttcactccttaagatgaattattatccgttcaaatccgactctacatattgcaa |
85 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28259009 |
tcaagtagtcaaaatttcactccttaagatgaattattatccgttcaaatccgactctacatattgcaa |
28259077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University