View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0984-Insertion-3 (Length: 1011)
Name: NF0984-Insertion-3
Description: NF0984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0984-Insertion-3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 5e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 5e-37
Query Start/End: Original strand, 643 - 873
Target Start/End: Complemental strand, 14946357 - 14946126
Alignment:
| Q |
643 |
agtgaggaaatagcaatgtagctggagggatgatcctacatgtctttaacatgaccttcttaaggtaaggaagagagggaaggactacctcatttaacag |
742 |
Q |
| |
|
|||| ||||||||||||| |||||||||| |||||| ||||| || | ||||||||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
14946357 |
agtgtggaaatagcaatggagctggagggtacatcctaagtgtctctaggacgaccttcttaaggtaaggaagttttggaaggtcaacctcatttaacaa |
14946258 |
T |
 |
| Q |
743 |
atgggat-gacctatataactgcacattccctcttttgctattatcatcacctctggatgggttaataaattagacatcgcccattccaaacttacggct |
841 |
Q |
| |
|
|||| | | ||||||||| || |||| ||||||||||| || ||| ||| ||||||||| |||||||||||||||| |||||||| ||| |||| ||| |
|
|
| T |
14946257 |
atggtcttgtcctatataagtgtccatttcctcttttgcttttttcaacacttctggatggtttaataaattagacattgcccattctaaagttacagct |
14946158 |
T |
 |
| Q |
842 |
gttgagtttgatcctgccaagagcctagccta |
873 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |
|
|
| T |
14946157 |
gttgagtttgatcctgcaaagagcatagccta |
14946126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 7e-24
Query Start/End: Original strand, 306 - 363
Target Start/End: Original strand, 14946091 - 14946148
Alignment:
| Q |
306 |
aaagaaatcacttcatattgataatttgcatcttttaggctatgctctttgcaggatc |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14946091 |
aaagaaatcacttcatattgataatttgcatcttttaggctatgctctttgcaggatc |
14946148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 113 - 157
Target Start/End: Complemental strand, 34683463 - 34683419
Alignment:
| Q |
113 |
caactgggaccacgtgaattaattctattattgggatttcgagtt |
157 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34683463 |
caactgtgaccacttgaattaattctattattgggatttcgagtt |
34683419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University