View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0985_low_3 (Length: 217)
Name: NF0985_low_3
Description: NF0985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0985_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 51195979 - 51195834
Alignment:
| Q |
1 |
tatatatgctcttcctcgaacaaaggttttctcattcacatatatatgcaattgccgtaacgctcttgtcgatgcatctaaatgacacaccacatgacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51195979 |
tatatatgctcttcctcgaacaaaggttttctcattcacatatatatgcaattgccgtaacgctcttgtcgatgcatctaaatgacacaccacatgacca |
51195880 |
T |
|
| Q |
101 |
ccattgcaaggaaaactttcgatacatctaatacaatacttcttct |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51195879 |
ccattgcaaggaaaactttcgatacatctaatacaatacttcttct |
51195834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University