View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0987_high_3 (Length: 214)
Name: NF0987_high_3
Description: NF0987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0987_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 24 - 205
Target Start/End: Complemental strand, 12636967 - 12636786
Alignment:
Q |
24 |
caaatatcaacctgtttgcacaaacttaaaccatcattcatctcataggccgcaaatattaggtctagtaaggattaatgacgttgtttatggaaaacca |
123 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
12636967 |
caaatatcaacctgtttgcacaaacttaaaccatcattcatctcataggccgcaaatattaagtctagtaaggattaatgacgttgtttatggaaaacca |
12636868 |
T |
 |
Q |
124 |
atagatgcttcatccaacaatcatgatcccttctagatcaatataattgtttgatgcccacacaatcctaagtcattcatat |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
12636867 |
atagatgcttcatccaacaatcatgatcccttctagatcaatataattctttgatgcccacacaatcctaagtcattcatat |
12636786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University