View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0989-Insertion-11 (Length: 189)
Name: NF0989-Insertion-11
Description: NF0989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0989-Insertion-11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 8 - 189
Target Start/End: Original strand, 9812141 - 9812322
Alignment:
| Q |
8 |
gcgcgaatggaggcagtatcatattatgataaaaaatgaattgtctgcaagtgatttaaacattgacttgtaagaaagatgccaatagtgagctaaggag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9812141 |
gcgcgaatggaggcagtatcatattatgataaaaaatgaattgtctgcgagtgattcaaacattgacttgtaagaaatatgccaatagtgagctaaggag |
9812240 |
T |
 |
| Q |
108 |
aattgttaaattttgtaaggctctattatctagcaaccgaaatttatatcagtaacagaaactacctaaatcttccctataa |
189 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9812241 |
aattgttaaattttgtgaggctctattatctagcaaccaaaatttatatcagtaacagaaactacctaaatcttccctataa |
9812322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 8e-32; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 8e-32
Query Start/End: Original strand, 8 - 144
Target Start/End: Complemental strand, 14154728 - 14154592
Alignment:
| Q |
8 |
gcgcgaatggaggcagtatcatattatgataaaaaatgaattgtctgc-aagtgatttaaacattgacttgtaagaaagatgccaatagtgagctaagga |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||||||||||| |||||||| || | |||||| ||||||||||| |||||||||||||| ||| |
|
|
| T |
14154728 |
gcgcgaatggaggcagtataatattatgattgaaa-tgaattgtctgccaagtgattcaagctttgactagtaagaaagataccaatagtgagctaggga |
14154630 |
T |
 |
| Q |
107 |
gaattgttaaattttgtaaggctctattatctagcaac |
144 |
Q |
| |
|
|||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
14154629 |
gaattgttgaattttgtaaggttctgctatctagcaac |
14154592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 189
Target Start/End: Complemental strand, 14148424 - 14148381
Alignment:
| Q |
147 |
aaatttatatcagtaacagaaactac-ctaaatcttccctataa |
189 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14148424 |
aaatttatatcagtaacagaaactacactaaatcttccctataa |
14148381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University