View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0989-Insertion-12 (Length: 182)
Name: NF0989-Insertion-12
Description: NF0989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0989-Insertion-12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 4e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 8 - 181
Target Start/End: Complemental strand, 53900425 - 53900253
Alignment:
| Q |
8 |
ggatatgaatgcattaaattgtagcaatattgtgagaagcatggaaaagaggttagccaggtaggtgacatgactcaatagtaaacatattgatagctgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53900425 |
ggatatgaatgcattaaattgtagcaatattgtgagaagcatggaaaagaggttagccaggtaggtgacatgactcaatagtaa-catattgatagctgt |
53900327 |
T |
|
| Q |
108 |
ttttaattaaggtcacgagaacggttggatgcagctgtctgctgtaatttctgcacctaaccctttacttcacg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53900326 |
ttttaattaaggtcacgagaacggttggatgcagctgtctgctgtaatttctgcacctaaccctttacttcacg |
53900253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University